pylori culture, one each from the antrum, corpus, and cardia. These were stained with haematoxylin and eosin and reviewed for the H. pylori-related histology by the updated Sydney’s system [4, 22, 23]. In addition, the study collected 181 H. pylori isolates for the detection of dupA genotype by PCR. One hundred and three isolates were collected from randomly selected patients who had agreed
to undergo SNP analysis, while 78 isolates were from patients without SNP analysis. The H. pylori culture were conducted from the two additional gastric www.selleckchem.com/Caspase.html biopsies collected during the same endoscopy and processed with the method applied in previous publications [4, 22]. For those with positive H. pylori culture, the isolates were extracted for genomic DNA to be analyzed for the dupA genotypes by PCR. The extraction of DNA was done with the same method as described previously [4, 22]. Positive H. pylori infection was defined by positive histology or culture. Genotypes of SNPs in MMPs and TIMPs Peripheral blood 8 ml was obtained from each subject for genomic DNA, which was extracted from peripheral blood mononuclear cells according Selleck HDAC inhibitor to the manufacturer’s instructions (Viogene, Taipei, Taiwan). Five SNPs in
MMP-3-1612 5A/6A, MMP-7-181 A/G, MMP-9exon 6 A/G, Wnt tumor TIMP-1372 C/T, and TIMP-2-418 G/C polymorphisms were determined by PCR-RFLP assays [18, 24–26]. Using the extracted DNA as template, the regions of each MMP and TIMP were amplified by PCR using commercially available kits (GoTaq® Green Master Mix, Promega, Madison, WI, USA) following the manufacturer’s instructions. The sequences of primers, PCR conditions, and restriction enzymes (obtained from New England Biosciences, U.S.) used were summarized in Table 1. After digestion, the products were separated by electrophoresis on a 4% agarose gel. The MMP and TIMP genotypes were shown as different gel examples (Figure 1). Table 1 The PCR primers
used in the study SNP/gene Primer sequence (5′ →3′) Size (bp) Restriction enzyme Reference MMP-3 -1612 5A/6A GATTACAGACATGGGTCACG 120 Xmn I Shibata et al, 2005 TTTCAATCAGGACAAGACGAAGTTT 6A: 120 bp 5A: 97 bp + 23 bp MMP-7 -181 A/G TGGTACCATAATGTCCTGAAT Phosphoglycerate kinase 150 EcoR I Jormsjö et al, 2001 TCGTTATTGGCAGGAAGCACACAATGAATT A: 150 bp G: 120 bp + 30 bp MMP-9 exon6 A/G CCATCCATGGGTCAAAGAAC 295 Sma I Shibata et al, 2005 * GGGCTGAACCTGGTAGACAG A: 295 bp G: 192 bp + 103 bp TIMP-1 372 C/T GCACATCACTACCTGCAGTC 175 BssSI Wollmer et al, 2002 GAAACAAGCCCACGATTTAG T: 175 bp C: 152 bp + 23 bp TIMP-2 -418 G/C CGTCTCTTGTTGGCTGGTCA 304 BsoBI Zhou et al, 2004 CCTTCAGCTCGACTCTGGAG C: 253 bp + 51 bp G: 230 bp + 51 bp + 23 bp jhp0917_1 TGGTTTCTACTGACAGAGCGC 307 – Lu et al.