Subsequently, comparisons with published mitochondrial genomes for dugongs (AJ421723: Arnason et al. 2002 and AY075116) revealed six mismatches in the forward primer and 2–3 mismatches in the reverse primer. A new dugong-specific forward primer DLF (5′ CATATTACAACGGTCTTGTAAACC

3′) and reverse primer DLR (5′ GTCATAAGTCCATCGAGATGTC 3′) were designed, amplifying a fragment of 615 bp. The 5′ primer is positioned in the tRNAPro and the 3′ primer in the central conserved domain of the control region. Primers used for PCR were also used as sequencing primers. DNA amplification (PCR) was carried out in 25 μL reactions: 1 ×  PCR buffer, 2 mM MgCl2, 0.16 mM dNTPs, 1 ×  Q solution (Qiagen), and 1 unit of Taq DNA polymerase (Qiagen or Bioline Inc.), using the following amplification profile: 5 min at 96°C followed by 30 cycles of: 30 s at 96°C, 30 s at 50°C, 1 min at 72°C, with a final step find more of 10 min at 72°C. PCR products were excised from a 1% agarose gel containing 40 mM Tris-acetate, 1 mM EDTA and purified using

a QIAquick gel purification kit (Qiagen) following the manufacturer’s instructions. Sequencing was done with ABI BigDye Terminator v3.1 chemistry (Applied Biosystems) and run on an ABI 377 sequencer, or ET chemistry (GE Biosciences) and run on a MegaBACE 1000 machine. Forward and reverse selleck compound sequences for each sample were verified using Sequencher 3.1.1 (GeneCodes) and aligned in Se-Al v1.0a1 (Rambaut 1996) or BioEdit (Hall 1999). Because of the presence of multiple identical haplotypes and of haplotypes differing from each other by few substitutions, we regarded a median-joining network (Bandelt et al. 1999) as an excellent way to present the data. The network was constructed from 上海皓元医药股份有限公司 pairwise sequence differences using the program Network v4.2.0.0 (http://www.fluxus-engineering.com/sharenet.htm). Epsilon was set to zero; “connection cost” was set as the median vector criterion; each character was weighted 10; transitions and transversions

were equally weighted. Basic summary statistics, calculated using DnaSP v5.10 (Rozas et al. 2003, Librado and Rozas 2009), were haplotypic diversity (h) (Nei 1987) and nucleotide diversity (π) (Nei 1987). DnaSP v5.10 was also used to calculate neutrality indices and, by simulation (1,000 replicates, assuming no recombination), their associated expected distributions. Ramos-Onsins and Rozas (2002) and Ramírez-Soriano et al. (2008) suggested that the most robust neutrality indices for detecting the signature of population growth were Fu’s FS (Fu 1997) and the R2 statistic (Ramos-Onsins and Rozas 2002). We did not estimate the widely used, but more conservative, Tajima’s D (Tajima 1989) because of its low resolving power (Ramírez-Soriano et al. 2008, Lohse and Kelleher 2009). Nor did we use statistics associated with mismatch distributions (Harpending 1994).