FADD-deficient mouse embryonic fibroblasts undergo RIPK1-dependent apoptosis and autophagy after NB-UVB irradiation

Maja Antunovica, Igor Matica, Biserka Nagya, Katarina Caput Mihalica, Josipa Skelina, Jerko Stambuka, Pavle Josipovica, Tamara Dzinica, Mladen Paradzikb, Inga Marijanovica,

Abstract

Autophagy Sun or therapy-related ultraviolet B (UVB) irradiation induces different cell death modalities such as apoptosis, necrosis/necroptosis and autophagy. Understanding of mechanisms implicated in regulation and execution of cell death program is imperative for prevention and treatment of skin diseases. An essential component of deathinducing complex is Fas-associated protein with death domain (FADD), involved in conduction of death signals of different death modalities. The purpose of this study was to enlighten the role of FADD in the selection of cell death mode after narrow-band UVB (NB-UVB) irradiation using specific cell death inhibitors (carbobenzoxyvalyl-alanyl-aspartyl-[O-methyl]- fluoromethylketone (zVAD-fmk), Necrostatin-1 and 3-Methyladenine) and FADD-deficient (FADD−/−) mouse embryonic fibroblasts (MEFs) and their wild type (wt) counterparts. The results imply that lack of FADD sensitized MEFs to induction of receptor–interacting protein 1 (RIPK1)-dependent apoptosis by the generation of reactive oxygen species (ROS), but without activation of the proteins p53, Bax and Bcl-2 as well as without the enrolment of calpain-2. Autophagy was established as a contributing factor to NB-UVB-induced death execution. By contrast, wt cells triggered intrinsic apoptotic pathway that was resistant to the inhibition by zVAD-fmk and Necrostatin-1 pointing to the mechanism overcoming the cell survival.
These findings support the role of FADD in prevention of autophagy-dependent apoptosis.

Keywords:
FADD
NB-UVB irradiation
Cell death inhibitors
RIPK1-dependent apoptosis

1. Introduction

UVB emitting only wavelengths of 311–312 nm (narrow band ultraviolet B radiation, NB- UVB) has been widely used for treatment of different skin conditions (psoriasis, atopic dermatitis, vitiligo and other inflammatory dermatoses). Although UV has beneficial effects on human health, it is implicated in etiology of inflammation [1], photoageing [2], DNA damage and hence, skin cancer [3]. If UVB-induced cell damage is irreparable, it triggers activation of apoptotic mechanisms. Extrinsic apoptotic pathway involves activation of death receptors directly or indirectly [4], while execution of intrinsic apoptotic pathway involves sustained activation of p53 and other transcription factors leading to increased expression of the pro-apoptotic Bcl-2 family members and mitochondrial damage followed by cytochrome c release from mitochondria and subsequently, activation of the caspase cascade [4,5]. Thus, apoptosis has crucial role in normal skin turnover and preservation of skin homeostasis. In contrast, death by necrosis is detrimental and accidental, provoking inflammation and immune response [6]. Tumor necrosis factor (TNF) can induce cell death with necrotic features involving activation of death receptors. This form of programmed necrosis is named necroptosis [7]. At the molecular level, necroptosis is dependent upon formation of necrosome through cooperation of two kinases: receptor-interacting protein 1 (RIPK1) and receptor-interacting protein 3 (RIPK3) [8–12]. Additionally, UVB-induced cell damage can trigger autophagy, manifested in gain of autophagosome formation and upregulation of autophagy markers. Mechanism restraining UV-induced autophagy is not entirely understood and usually is dependent on the context in which it occurs considering that autophagy can have either suppressive or pro-tumorigenic role in development of skin cancer [13].
Fas-associated protein with death domain (FADD) is not only crucial adaptor protein in death receptor-mediated apoptosis, but also vital for successful conduction of apoptosis triggered without enrolment of death receptors, necrosis/necroptosis and autophagy [14]. Caspase-8, FLICE-inhibitory protein (FLIP), RIPK1 and RIPK3 assemble in the same complex through FADD, as scaffold [15]. Apoptosis may be mediated by binding of RIPK1, importantly independent of its kinase activity, with FADD that sequentially induces auto-catalytic activation of procaspase8 followed by amplification the apoptotic signaling pathway and cell death (RIPK1-independent apoptosis) [16]. Apoptosis may be also mediated in RIPK1-dependent manner upon RIPK1-kinase activation following the interaction with FADD, activation of caspase-8 and consequentially, execution of apoptotic program. Under apoptotic deficient conditions, RIPK1 may be activated to promote necroptosis by interacting with RIPK3 which in turn phosphorylates and recruits mixed lineage kinase domain-like (MLKL) protein, creating protein complex at plasma membrane and mediating the execution of necroptosis [17]. Thus, activated RIPK1 might be engaged to mediate either RIPK1-dependent apoptosis or necroptosis, relying on its kinase activity. Analyzing the role of FADD in autophagy, it can be found that Atg5-12 complexes involved in autophagic vacuole formation, interact with FADD and recruit to autophagosomes [18–20]. Following activation of autophagy, besides FADD, RIPK1 and RIPK3 are recruited to autophagosomes as well [21]. Absence of FADD is associated with proliferative advantage of cancer cells [22,23], whereas significant upregulation of FADD was noticed in other tumors, such as, ovarian cancer [24] and head and neck squamous cell carcinoma [25].
The cell death program, whether by apoptosis, necrosis/necroptosis or autophagy, is mediated through an integrated cascade, depended on cell type, cell death inducer and cellular milieu [26]. Balance in cell death modalities has to be tightly regulated process because disruption of signaling through these pathways or malfunction of the death machinery can lead to cancerous expansion of damaged cells or development of skin disease associated with defective cell death program. Current understanding of NB-UVB-induced cell death program is still insufficient and requires further investigation. Since FADD is involved in governing all three types of programmed cell death, we decided to enlighten the role of FADD in the selection of cell death mode upon NBUVB irradiation. For that reason, we applied inhibitors of specific cell death modality, carbobenzoxy-valyl-alanyl-aspartyl-[O-methyl]-fluoromethylketone (zVAD-fmk) for apoptosis, Necrostatin-1 (Nec-1) for necroptosis and 3-Methyladenine (3-MA) for autophagy, following irradiation of FADD-deficient mouse embryonic fibroblasts and wild type counterparts and analyzed specific molecular features attributed to each cell death modality.

2. Materials and Methods

2.1. Cell Lines, Induction and Inhibition of Cell Death

Culture conditions for wt and FADD−/− MEFs have been previously described [27] as well as their generation from mice [28]. In order to induce cell death by NB-UVB, both cell lines at 80% confluence stage, were exposed to irradiation emitting only 312 nm (UVItec Ltd., Cambridge, UK). The NB-UVB dose (100–600 J/m2) was monitored with UVB dosimeter (UVItec Ltd). After irradiation, fresh medium was added followed by incubation in a cell culture incubator (37 °C, 5% CO2) for 24, 48 and 72 h, respectively. Control cells (negative control) were treated equally, except that the UVB lamp was turned off. As pancaspase inhibitor we used zVAD-fmk (20 μM, Becton Dickins, Franklin Lakes, NJ, USA). Cells were pre-incubated for 24 h with zVAD-fmk and/ or Nec-1 (50 μM, Sigma-Aldrich, Taufkirchen, Germany) before NBUVB-exposure. As a control of caspase-dependent apoptosis, the cells were incubated 24 h with TNFα/cyclohexamide (50 ng/ml/10 μg/ml, Sigma-Aldrich) and as a control of autofagosome formation; the cells were incubated 48 h with quercetin (160 μM, Carl Roth, Karlsruhe, Germany). As a control of phosphorylated p53 at serine 15, HeLa cells were treated with UVC (germicidal lamp) and assessed for protein isolation 60 min after irradiation. For positive control of calpain-2 activation we treated wt cells with CaCl2 (2 mM) for 60 min. Inhibitor 3MA (Sigma-Aldrich), final concentration 10 mM, was applied 1 h before exposure to 312-nm UV light.

2.2. The MTT Viability Assay

Both cell lines were seeded at a density of 2.5 × 103 cells per well of a 96-well plate in 200 μl of culture medium. The next day the medium was removed and the cells were exposed to NB-UVB (doses of 100–600 J/m2). The MTT cell viability assay was performed for next three days. 40 μl of tetrazolium dye 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (Sigma-Aldrich), diluted in medium to final concentration of 0.5 mg/ml, was added to each well. Following the incubation period of 3 h at 37 °C, 170 μl of dimethyl sulfoxide (SigmaAldrich) was added per well. The absorbance of solution was quantified by measuring wavelength at 570 nm using microtiter plate reader (Lybsystems, Helsinki, Finland). Cell viability of treated cells was calculated in reference to the untreated control of each cell line and expressed as percent (%). Each sample was performed in triplicates.

2.3. Analysis of Cell Death by Flow Cytometry

FITC Annexin V/Dead Cell Apoptosis Kit (Invitrogen/Thermo Fisher Scientific, Waltham, MA, USA) was used for identification of viable, early apoptotic, late apoptotic/necrotic and necrotic cell populations. Following NB-UVB irradiation and/or inhibitor treatment, cells were collected and resuspended in 100 μl of annexin binding buffer. 5 μl of FITC Annexin V and 1 μl of propidium iodide were added following analyses by flow cytometry (FACScalibur, Becton Dickinson) in the total population (20,000 cells). Data analyses were performed using FACS Diva analysis software (Becton Dickinson).

2.4. Caspase-8, -9 and -3 Activity Assay

We used Caspase-8, -9 and -3 Colorimetric Protease Assays (Invitrogen, Carlsbad, CA, USA) for assaying the activity of caspases in lysates of wt and FADD−/− MEFs treated with NB-UVB irradiation and/ or Nec-1 and zVAD-fmk inhibitors, as stated in manufacturer’s protocol. The assays were based on spectrophotometric detection of the specific chromophore p-nitroaniline (p-NA) after cleavage from the labeled substrate, characteristic for each caspase. The p-NA light emission was quantified using a microtiter plate reader (Lybsystems) at 400 nm. Comparison of the absorbance of p-NA from wt and FADD−/− MEFs with an uninduced control of each cell type, allowed us determination of the fold increase in Caspase-8, -9 and -3 activities. Each sample was performed in duplicates.

2.5. RNA Extraction and Real-time Quantitative PCR (RT-qPCR)

Total RNA (2 μg) was isolated using TRIzol reagent (Invitrogen) according to manufacturer’s instructions following DNase I (New England Biolabs, Ipswich, MA, USA) treatment. Synthesis of cDNA was performed under the following conditions: 10 min at RT, 1 h at 42 °C, 5 min at 99 °C and 5 min at 5 °C. Power SYBR Green Mastermix (Applied Biosystems, Foster City, CA, USA) was used to analyze the expression of Bax and Bcl-2. Used primers were following: mouse Bax forward primer 5′- CCTTTTTGCTACAGGGTTTC, mouse Bax reverse primer 5′- ATATT GCTGTCCAGTTCATC, mouse Bcl2 forward primer 5′- ATGACTGAGTA CCTGAACC, mouse Bcl2 reverse primer 5′- ATATAGTTCCACAAAGGC ATC, mouse Actb forward primer 5′- GATGTATGAAGGCTTTGGTC, and Actb reverse primer 5′- TGTGCACTTTTATTGGTCTC (Sigma-Aldrich). RT-qPCR was performed on the 7500 Fast PCR system (Applied Biosystems) under following conditions: 10 min at 95 °C for 1 cycle, 15 s at 95 °C and 1 min at 60 °C for 40 cycles. Expression levels were normalized to β-actin while ΔΔCt method was used to calculate relative gene expressions.

2.6. Western Blot Analysis

Following protein isolation and determination of protein concentration, 5 μg of proteins were separated by gel electrophoresis using precast polyacrylamide gels (GE Healthcare, Life Sciences) as previously described [29]. In short, proteins were transferred to nitrocellulose membrane (Whatman, Protran) which was blocked in 5% non-fat milk for 1 h at room temperature and incubated overnight at 4 °C with one of the following antibodies: anti-PARP-1 (Santa Cruz Biotechnology, Dallas, TX, U.S.A., diluted 1:1000), anti-phospho p53 (Ser15) (Cell Signaling Technology, Danvers, MA, USA, diluted 1:1000), anti-Bax (Santa Cruz Biotechnology, diluted 1:500), anti-Bcl-2 (Santa Cruz Biotechnology, diluted 1:500), anti calpain-2 (Cell Signaling Technology, diluted 1:1000), anti-LC3-B (Cell Signaling Technology, diluted 1:1000), anti-Beclin-2 (Cell Signaling Technology, diluted 1:1000) or anti-GAPDH (Sigma-Aldrich, diluted 1:5000). Horseradish peroxidase secondary antibody (Cell Signaling Technology, diluted 1:2000) was incubated for 1 h at room temperature. Immunoblotting products were visualized with detection reagent kit (GE Healthcare, Life Sciences) according to manufacturer’s instruction. Autoradiography developer and fixer (Sigma-Aldrich) were used to develop films of high sensitivity (GE Healthcare, Life Sciences). Densities of western blot bands were measured with ImageJ software (NIH, USA).

2.7. Detection of Autophagic Cells by Fluorescent Staining With Acridine Orange

Cells were seeded on cover slips in concentration 3 × 104 cells per ml of medium. 24 h after the culture medium was removed and cells were exposed to 300 J/m2 and returned at 37 °C in a humidified atmosphere containing 5% CO2 for 24 h. Following initial treatment, cells were incubated with medium without fetal bovine serum, containing 2 μg/ml acridine orange (Invitrogen) for 15 min at 37 °C; the acridine orange was then removed, cells were washed once with phosphatebuffered saline (Gibco Laboratories, Gaithersburg, MD, USA), and fluorescent micrographs were taken using an Olympus fluorescence microscope (Olympus BX51). All images are presented at the same magnification.

2.8. Cytosolic ROS Detection

Intracellular ROS generation was determined by a fluorometric microplate assay by assessing oxidation of 2′, 7′-dichlorofluorescindiacetate (DCFH-DA) (Sigma-Aldrich). In brief, cells were incubated with 5 μM DCFH-DA in medium at 37 °C for 30 min in the dark, and then washed with PBS to remove excess dye. Fluorescence was measured using VICTOR X Multilabel Plate Reader (PerkinElmer, Walthman, MA, USA). ROS production values are expressed as mean + SD, relative to average control values.

2.9. Transmission Electron Microscopy (TEM)

For ultrastructural analyses, cells were fixed for 30 min with 2% glutaraldehyde in 0.05 M cacodylate buffer (pH 7.2) at 2 °C. Upon rinsing with the cacodylate buffer, the cells were postfixed for 2 h with 1% (vol. ratio) osmium tetroxide in the same buffer at 2 °C. The samples were dehydrated through an ethanol series and embedded in Spurrˈs resin. Ultrathin sections were stained with uranyl acetate and lead citrate and examined using electron microscope (268D, FEI Morgagni, Hillsboro, OR, USA) operated at an accelerating voltage of 70 kV.

2.10. Statistical Analysis

A statistical analysis of the data was performed using Breakdown & one-way ANOVA analysis of variance followed by Duncan test employing the STATISTICA 12 program (StatSoft, Dell Statistica, Tulsa, OK, USA). Statistical significance was set at P < .05 and P < .01, respectively.

3. Results

3.1. FADD-deficient Cells Had Lower Survival Rate After Exposure to NBUVB

In order to compare cytotoxic response to NB-UVB irradiation between cell lines, cell viability was determined 24, 48 and 72 h after exposure using the MTT assay. Exposure of cells to increasing doses of NB-UVB (0–600 J/m2) resulted in a dose-dependent decrease in cell viability. Moreover, FADD−/− cells showed significant reduction of viability compared to wt cells, especially 72 h after exposure (Fig. 1a). The half-minimal inhibitory concentrations. (IC50) were determined and shown in Fig. 1b. The dose of 300 J/m2 represents the IC50 value for both lines (48 h). Therefore, we decided to use this dose to investigate NB-UVB mechanism(s) underlying FADDdependent cell death modalities.

3.2. Pretreatment with Nec-1 and zVAD-fmk Following Irradiation, Saved FADD-deficient Cells from NB-UVB-induced Cell Death

In order to define a prevalent type of cell death following irradiation with 300 J/m2, we employed Annexin V/PI staining. To identify underlying cell death mechanism, we applied pharmacologic inhibitors, zVAD-fmk (20 μM) and Nec-1 (50 μM) 24 h before exposure to NB-UVB. The cells were collected, stained and analyzed by flow cytometry after 24 h and 48 h, respectively.
The results indicate that 24 h post irradiation, NB-UVB triggered early apoptosis and late apoptosis/necrosis of wt cells (Fig. 2b) while FADD−/− cells died predominantly by necrosis (Fig. 2c). Nec-1 successfully inhibited necrotic death of FADD−/− cells (Supplemental 1c) and reduced percent of late apoptotic/necrotic FADD−/− cells (Supplemental 1c), promoting cell survival (Supplemental 1b), respectively. Surprisingly, treatment with zVAD-fmk before irradiation did not save wt cells from death. In addition, Nec-1 added before irradiation, reduced percent of viable wt cells (Supplemental 1a).
Cytometric analysis of cell populations (%) 48 h after irradiation and pretreatment with cell death inhibitors were shown in Fig. 3a. NBUVB caused increase in early apoptotic (Fig. 3c) and late apoptotic/ necrotic populations of both cell lines (Fig. 3d). Distinction between cell lines following irradiation, was two-fold increase of late apoptotic/necrotic population of FADD−/− cells (Fig. 3d) and dicrease of viable cell population compared to wt (Fig. 3b). Inhibitor zVAD-fmk successfully inhibited late apoptosis/necrosis of FADD−/− cells and thus, increased viability (Fig. 3d and b). Pretreatment of wt cells with zVAD-fmk before exposure to NB-UVB, induced even more early apoptotic cells (Fig. 3d) while pretreatment with Nec-1 induced more late apoptotic/necrotic wt cells (Fig. 3d). Both inhibitors reduced percent of viable wt cells, failing to rescue them from death (Fig. 3b). The results indicate that neither inhibitor could save wt cells from NB-UVB-induced cell death as they manage to die by some other death mechanism.

3.3. Analysis of Cell Death Morphology Following Irradiation by Transmission Electron Microscopy

Morphological features of specific cell death type in response to irradiation were characterized by transmission electron microscopy (TEM) 48 h post irradiation (Fig. 4). TEM micrographs indicated plasma membrane blebbing and shedding of apoptotic bodies as evidence of apoptotic cell death of wt cells (Fig. 4c). The only apoptotic feature observed in FADD−/− cells was condensation of nuclear chromatin. In the cytoplasm, it was observed a massive accumulation of vacuoles (Fig. 4d).

3.4. Pretreatment of FADD-deficient Cells with Nec-1 Inhibits PARP-1 Cleavage Induced by NB-UVB Irradiation Indicating RIPK1-dependent Apoptotic Death

Since activation of caspases is hallmark of apoptosis, we evaluated relative activity of initiator caspases (-8 and -9) and executioner caspase-3, 24, 48 and 72 h after exposure to 300 J/m2 (Fig. 5a). The results showed that NB-UVB irradiation barely increased relative activity of caspase-8 in both cell lines 72 h after NB-UVB exposure. On contrary, caspase-9 relative activities were increased at all-time points in both cell lines. However, FADD−/− cells increased caspase-9 activity earlier and stronger then wt cells. Following the induction of caspase-9, caspase-3 relative activity was also induced in both cell lines, also at higher rate in FADD−/− cells. Since relative activation of caspase-8 in both cell lines barely occurred 72 h after exposure to NB-UVB, it is more probable that it is contributed to caspase-3 and/or − 9 feedback loop, implying that caspase-8 is not involved in regulation of analyzed cell death mechanisms. Consistent with previous reports [27], the results suggested the involvement of mitochondrial (intrinsic) pathway in apoptotic mechanisms in wt cells but also implicate FADD for regulation of the caspase-9 and -3 activity levels. Comparing given results with results obtained by Annexin V/PI staining, it can be concluded that despite the fact that caspase-3 and -9 were selectively activated in wt cells, caspase inhibitor i.e. zvad-fmk colud not efficiently block NB-UVB-induced cell death.
The activities of effector caspases can also be estimated by detection of substrate protein PARP-1. The active caspases-3 and -7 cleave PARP1 into two specific fragments: an 89-kD catalytic fragment and a 24-kD DNA binding domain [30]. Western blot analysis confirmed that the dose of 300 J/m2 induced cleavage of PARP-1 protein regardless of FADD presence, due to the activity of caspase-3 in both cell lines (Fig. 5b). Differences in PARP-1 (116 kDa) levels between two lines became visible when specific inhibitors were applied before NB-UVB irradiation (Fig. 5b). 48 h post irradiation, levels of PARP-1 protein in wt samples were decreased when treated with Nec-1 and zVAD-fmk alone or in combination, respectively, when compared to appropriated FADD−/− samples. PARP-1 levels in FADD−/− samples treated with Nec-1 were same as PARP-1 levels of untreated control. The results indicated that Nec-1 could inhibit entirely activity of effector caspases in FADD−/− cells. Inhibitor zVAD-fmk increased levels of PARP-1 in FADD−/− samples as well (Fig. 5c).

3.5. NB-UVB-induced RIPK1-dependent Apoptosis Did Not Involve Bax nor Bcl-2

Results given by RT-qPCR confirmed NB-UVB-induced apoptosis of wt cell since the ratio of Bax to Bcl-2 predisposes the susceptibility to apoptosis [31]. Expression levels of Bax and Bcl-2 in wt samples following zVAD-fmk and/or Nec-1 prior to irradiation were very similar. In FADD deficient cells expression levels of Bax and Bcl-2 were lower than wt control levels. The only exception was FADD−/− sample treated with Nec-1 before irradiation which showed significant elevation of relative Bax mRNA expression (Fig. 6a).
Western blot analysis showed that NB-UVB irradiation reduced levels of anti-apoptotic protein Bcl-2 in both cell lines, as expected. However, the difference in Bax expression after irradiation was noticed between FADD−/− and wt cells (Fig. 6b). The treatment with Nec-1 before irradiation up-regulated Bax protein levels in FADD−/− and down-regulated the levels of Bax in wt cells. The level of Bcl-2 was not altered by Nec-1 pretreatment in neither cell lines. The results suggest that NB-UVB-induced cell death of FADD−/− cells did not involve Bax nor Bcl-2, since expression of Bax is achieved only when FADD is present and RIPK1 active (Fig. 6b).

3.6. DNA-damage Response to NB-UVB through Activation of p53 Is Not a Probable Inducer of Cell Death Regardless of FADD Status

To investigate the transcriptional involvement of p53 in NB-UVB induced cell death mechanisms in wt and FADD−/− cells, we did western blot analysis of phospho-p53 at Ser15 after 48 h. Phosphorylation of Ser15 causes activation of p53 as a transcription factor in response to DNA damage [32,33]. The results showed that NBUVB did not induce phosphorylation of p53 at Ser15 in neither cell lines. However, zVAD-fmk and combination of zVAD-fmk and Nec-1 before irradiation, induced activation of p53 in both cell lines, as well as the treatment with Nec-1 in wt cells. Only treatment with Nec-1 (Fig. 6c).

3.7. RIPK1-dependent Apoptosis Involves Cytosolic Reactive Oxygen

Species (ROS) Production but Not Calpain-2 Activation UVB induces generation and accumulation of ROS inside cells, causing damaging effects [34]. NB-UVB-induced production of ROS was observed only in FADD-deficient cells and Nec-1 pretreatment successfully reduced its levels (Fig. 7a). Since calpains have been implicated in apoptotic cell death, and appear to have an essential role in necrosis/necroptosis, we wanted to test hypotheses that m-calpains (calpains-2) are not responsible for caspase activation in NB-UVB-induced cell death. Thus, we analyzed activation of calpain-2 by western blot. The results did not reveal any significant difference between these death modalities. After exposure to NB-UVB, endogenous levels of total calpain-2 declined in both cell lines. The difference was noticed between wt and FADD−/− controls, since untreated FADD−/− cells expressed calpain-2 autoproteolytically cleaved at serine 20 (Fig. 7b).

3.8. RIPK1-dependent Apoptosis Involves Autophagy as a Contributing Factor

Since Atg5 interacts with death domain of FADD [19], we investigated whether NB-UVB triggered FADD-dependent autophagy. Acridine orange was used as autophagy assay since it crosses into lysosomes and other acidic compartments and becomes protonated and stacked, emitting in the red range. Results given by fluorescent staining with acridine orange 48 h after irradiation showed more protonated dye in FADD−/− cells emitting red fluorescence compared to wt cells. Acridine orange that was not in acidic compartments emitted green (Fig. 8a).
Results were quantified analyzing conversion of LC3-I to LC3-II by western blot 48 h after irradiation. Microtuble-associated protein light chain 3 (LC3), transforms from LC3-I to LC3-II as the autophagic process progresses and thus, is used as autophagosomal marker [35]. The induction of autophagosomes was observed in FADD−/− cells after NBUVB irradiation (Fig. 8b). Addition of Nec-1 inhibited vacuole formation (decreased levels of LC3-II) in FADD−/− cells, indicating that RIPK1 is activated in NB-UVB-induced autophagic process. Consistent with previous results, treatment with zVAD-fmk decreased levels of LC3-II as well, suggesting that caspase activity supports formation of autophagosomes. Wild type cells increased levels of LC3-II only when Nec-1 was added prior to irradiation. Otherwise, LC3-II was not detected by western blot in wt samples (Fig. 8b).
TEM micrographs indicated NB-UVB-induced massive vacuolization of the cytoplasm as well as accumulation of (double-membraned) autophagic vacuoles in FADD−/− cells. Treatment with Nec-1 before exposure to NB-UVB induced formation of autophagic vacuoles in wt cells (Fig. 8c). All together these results imply that NB-UVB-induced RIPK1dependent apoptosis is also autophagy-dependent.
Western blot analysis of Beclin-1, an autophagy-related protein, revealed increased levels of protein in controlled samples of both cell lines. While wt cells upregulated Beclin-1 levels, FADD−/− cells downregulated levels of Beclin-1 after irradiation. Treatment with inhibitors before irradiation did not elevate Beclin-1 levels in neither cell line.
The inhibitor 3-MA (10 mM) was added in medium 1 h before exposure to NB-UVB following Annexin V/PI staining after 24 h and 48 h of incubation period. Results were analyzed by flow cytometry indicating percentages of specific cell populations as follows: Annexin V negative/PI negative (viable), Annexine V positive/PI negative (early apoptotic), Annexine positive/PI positive (late apoptotic/necrotic) and Annexine V negative/PI positive (necrotic) cells. Inhibitor 3-MA applied before irradiation, caused reduction of cell viability of wt cells (Fig. 9b). Some reduction of early apoptotic (Fig. 9c) and late/apoptotic wt cells did occur (Fig. 9d). The cells lacking FADD, enhanced percent of viable cells with pretreatment of 3-MA following reduction of late apoptotic/ necrotic population (Fig. 9b and d).
Analyzing results 48 h post irradiation and 3-MA pretreatment, we observed surprisingly, enhancement of viable populations of both cell lines, not only FADD-deficient (Fig. 10b). 3-MA inhibitor reduced percentages of early apoptotic (Fig. 10c) and late apoptotic/necrotic populations of both cell lines (Fig. 10d). The results established autophagy as a contributing factor to RPK1-dependent apoptosis of FADD−/− MEFs.

4. Discussion and Conclusions

Therapeutic potential of NB-UVB manifests in apoptotic clearance as preferable cell death mode. Induction of different cell death modalities such as necrosis/necroptosis and autophagy by NB-UVB cannot be excluded. FADD is adapter protein involved in conduction of death signals of different death modalities. Thus, understanding of mechanisms implicated in regulation of cell death by FADD protein, is essential for prevention and treatment of skin diseases.
The results given by MTT assay indicate that FADD plays role in survival since wt cells had better survival rate following irradiation compared to FADD deficient counterparts. Indeed, FADD has different assignments, which are dependent on its localization in the cell. If FADD is located in the cytoplasm, channels cell death signals, while in the nucleus, FADD supports cell survival [36]. Since the dose of 300 J/ m2 was established as IC50 value for both lines, it was used to investigate FADD-dependent cell death modalities. Similar, at the wavelength emitting 300 nm, minimal erythemal dose (MED) in humans is 200–300 J/m2 [37].
Nec-1 inhibits kinase activity of RIPK1 whose activity is thought to be required for necroptosis. Necrostatin-1-inhibitable cell death has efficiently become exclusive characteristic of necroptosis because Nec-1 inhibits this mode of cell death in different circumstances, providing conformation for evaluation of necrostatin analogues as possible therapeutic agents [38]. However, RIPK1-dependet apoptosis requires kinase activity of RIPK1 as well, whose activity likewise can be inhibited with Nec-1 [39]. Morphological and biochemical features used to designate apoptotic death are cell shrinkage, membrane blebbing, condensation and margination of nuclear chromatin, internucleosomal DNA cleavage, phosphatidylserine exposure and formation of apoptotic bodies. However, the hallmark of apoptotic process is its dependence on activation of executioner caspases [40]. RIPK1-dependet apoptosis, as any other apoptotic process, requires activation of capases following PARP-1 inhibition [41]. Morphological features of necroptosis are same as those of necrosis: loss of plasma membrane integrity, increase in cell volume, organelle swelling, lack of internucleosomal DNA fragmentation, and cellular collapse without caspase activation, but frequently, with activation of calpains [42].
ROS production by UVB irradiation is as an early cellular event [43]. Accumulation of excessive ROS, generated through the action of catalase, contributes to cellular damage (e.g. lipid peroxidation and DNA fragmentation), apoptosis and consequentially, the development of skin cancer. ROS acts as second messengers in activation of apoptotic signaling pathways [44]. NB-UVB-induced production of ROS was observed only in FADD-deficient cells and Nec-1 pretreatment successfully reduced its levels.
In this research, protective effect of Nec-1 against irradiation of FADD deficient cells was seen at many levels: in enhancement of cell viability, reduction of PARP-1 cleavage by caspases, inhibition of ROS production and, finally, inhibition of autophagic vacuole formation, suggesting enrolment of RIPK1 in cell death process.
When cells are irreparably damaged by UV irradiation, the best option is to undergo apoptosis. Bcl-2 and Bax are proteins of the Bcl-2 family, which suppress and stimulate apoptosis by administering the effect of mitochondrial membrane permeability, mitochondrial function and release of cytochrome-c [45]. Tumor suppressor p53 protein can be activated in response to stress such as irradiation, making it transcription factor, which regulates downstream target genes, including Bax. However, p53 can have a transcription-independent role in apoptosis [46]. Unlike regular NB-UVB-induced apoptosis of wt cells, RIPK1-dependent apoptosis of FADD deficient cells did not involve Bax or Bcl-2. Expression of Bax protein was achieved only when FADD was present (wt cells) and RIPK1 active (no inhibition with Nec-1).
To test hypotheses that calpains are not responsible for caspase activation in NB-UVB-induced RIPK1-dependent apoptosis, we analyzed activation of calpain-2 by western blot. During prolonged stress and DNA damage, Ca2+ could be released from endoplasmic reticulum (ER) causing imbalance in mitochondrial Ca2+ homeostasis and thus, enabling activation of Ca2+-dependent calpain Cys-proteases. Activated calpains-2 cleave Bcl-xL following activation of caspase-12 [47]. Activated caspase-12 then activates caspase-9 which accordingly activates caspase-3 [48]. Indeed, NB-UVB-induced activation of caspases is independent of calpain-2 activity.
Inhibitor zVAD-fmk is the most used pan-caspase inhibitor which restrains caspase-dependent apoptosis in most of the cells and after induction with different cell death stimuli, although opposite effects have been reported [46,49–51]. In this research, it was not efficient in preventing NB-UVB-induced apoptotic death of wt MEFs. We were not surprised because shifts between apoptotic, necrotic and autophagic cell deaths, were often triggered by zVAD-fmk [52–54]. In our study, zVAD-fmk decreased the levels of Bax and transactivated p53. Same effect was observed for FADD−/− MEFs. It was shown that zVAD-fmk could modify p53-transcriptional activities in rat embryonic fibroblasts [49]. Treatment of FADD−/− cells with zVAD-fmk prior to irradiation increased the levels of Bax, transactivated p53 an, reduced PARP-1 cleavage and inhibited vacuole formation.
Although, Atg5, key autophagy protein, interacts with FADD via death domain in vitro and in vivo [55], NB-UVB-induced autophagy was demonstrated only in FADD−/− cells and in wt cells pretreated with Nec-1. Induction of autophagy in FADD−/− cells was successfully inhibited by Nec-1 pretreatment implying that NB-UVB-induced RIPK1apoptosis is autophagy-dependent. Autophagy has been implicated in apoptotic death although its functional role is still under consideration [56], especially in context of NB-UVB [13]. Thus, we wonder whether 3-MA inhibiting autophagic sequestration, could promote survival of irradiated FADD−/− cells implying that autophagy was not merely consequence of RPK1-dependent apoptosis. 3-MA is an autophagy inhibitor which suppresses autophagy via inhibition of class III PI3K [57]. Indeed, 3-MA enhanced viability of FADD deficient cells 24 and 48 h after irradiation pointing autophagy as contributing factor to RIPK1dependent apoptosis. Although autophagy was not detected in wt cells, it enhanced the viability of wt cell 48 h after irradiation.
Western blot analysis of Beclin-1 levels after irradiation, revealed opposite cellular response between cell lines. While wt cells upregulate Beclin-1 levels, FADD-deficient cells downregulate levels of Beclin-1. Thus, Beclin-1 levels did not correspond to LC3B-II transition, or to results given by acridine orange staining and TEM. The possible explanation could be that Beclin-1has crucial role in controlling crosstalk between apoptosis and autophagy. Beclin-1 binds with its BH3 domain to the anti-apoptotic Bcl-2 family of proteins following induction of the mitochondrial permeability transition pore and activation of apoptosis. Thus, interaction of anti-apoptotic Bcl-2 family of proteins with Beclin1 is important for inhibition of autophagy [58–60].
Investigating the role of FADD in the selection of cell death mode upon irradiation of 312 nm, we showed that the lack of FADD sensitized mouse embryonic fibroblasts to induction of RIPK1-dependent apoptosis with ROS generation, but without activation of p53 and proteins Bax and Bcl-2 as well as without enrolment of calpain-2. Autophagy was established as a contributing factor to NB-UVB-induced death execution.
Very complex network of proteins is responsible for defining the cell death and survival mode after UVB irradiation. Probably due to the cell death continuum, it is difficult to obtain clear answers, so more research is needed to clarify the role of FADD in the selection of death mode after UVB irradiation.

References

[1] L.L. Hruza, A.P. Pentland, Mechanisms of UV-induced inflammation, J. Invest.Dermatol. 100 (1993) 35S–41S.
[2] U. Panich, G. Sittithumcharee, N. Rathviboon, S. Jirawatnotai, Ultraviolet radiation-induced skin aging: the role of DNA damage and oxidative stress in epidermal stem cell damage mediated skin aging, Stem Cells Int. 2016 (2016) 7370642, , https://doi.org/10.1155/2016/7370642.
[3] J. D’Orazio, S. Jarrett, A. Amaro-Ortiz, T. Scott, UV radiation and the skin, Int. J.Mol. Sci. 14 (2013) 12222–12248, https://doi.org/10.3390/ijms140612222.
[4] D. Kulms, E. Zeise, B. Pöppelmann, T. Schwarz, DNA damage, death receptor activation and reactive oxygen species contribute to ultraviolet radiation-induced apoptosis in an essential and independent way, Oncogenetics 21 (2002) 5844–5851, https://doi.org/10.1038/sj.onc.1205743.
[5] S. Lippens, E. Hoste, P. Vandenabeele, P. Agostinis, W. Declercq, Cell death in the skin, Apoptosis 14 (2009) 549–569, https://doi.org/10.1007/s10495-009-0324-z.
[6] K.L. Rock, H. Kono, The inflammatory response to cell death, Annu. Rev. Pathol.Mech. Dis. 3 (2008) 99–126, https://doi.org/10.1146/annurev.pathmechdis.3.121806.151456.
[7] A. Degterev, Z. Huang, M. Boyce, Y. Li, P. Jagtap, N. Mizushima, G.D. Cuny, T.J. Mitchison, M.A. Moskowitz, J. Yuan, Chemical inhibitor of nonapoptotic cell death with therapeutic potential for ischemic brain injury, Nat. Chem. Biol. 1 (2005) 112–119, https://doi.org/10.1038/nchembio711.
[8] S. He, L. Wang, L. Miao, T. Wang, F. Du, L. Zhao, X. Wang, Receptor interacting protein kinase-3 determines cellular necrotic Necrostatin 2 response to TNF-alpha, Cell. 137 (2009) 1100–1111, https://doi.org/10.1016/j.cell.2009.05.021.
[9] N. Holler, R. Zaru, O. Micheau, M. Thome, A. Attinger, S. Valitutti, J.L. Bodmer, P. Schneider, B. Seed, J. Tschopp, Fas triggers an alternative, caspase-8-independent cell death pathway using the kinase RIP as effector molecule, Nat. Immunol. 1 (2000) 489–495.
[10] D.-W. Zhang, J. Shao, J. Lin, N. Zhang, B.-J. Lu, S.-C. Lin, M.-Q. Dong, J. Han, RIP3, an energy metabolism regulator that switches TNF-induced cell death from apoptosis to necrosis, Science (80-. ) 325 (2009) 332–336, https://doi.org/10.1126/ science.1172308.
[11] J. Chen, Z.-D. Shi, X. Ji, J. Morales, J. Zhang, N. Kaur, S. Wang, Enhanced osteogenesis of human mesenchymal stem cells by periodic heat shock in self-assembling peptide hydrogel, Tissue Eng. Part A. 19 (2013) 716–728, https://doi.org/10.1089/ ten.TEA.2012.0070.
[12] I.E. Erickson, A.H. Huang, C. Chung, R.T. Li, J.A. Burdick, R.L. Mauck, Differential maturation and structure–function relationships in mesenchymal stem cell- and chondrocyte-seeded hydrogels, Tissue Eng. Part A. 15 (2009) 1041–1052, https:// doi.org/10.1089/ten.tea.2008.0099.
[13] A. Sample, Y.-Y. He, Autophagy in UV damage response, Photochem. Photobiol. 93 (2017) 943–955, https://doi.org/10.1111/php.12691.
[14] L. Tourneur, G. Chiocchia, FADD: a regulator of life and death, Trends Immunol. 31 (2010) 260–269, https://doi.org/10.1016/j.it.2010.05.005.
[15] J.S. Riley, A. Malik, C. Holohan, D.B. Longley, DED or alive: assembly and regulation of the death effector domain complexes, Cell Death Dis. 6 (2015), https:// doi.org/10.1038/cddis.2015.213.
[16] F.C. Kischkel, S. Hellbardt, I. Behrmann, M. Germer, M. Pawlita, P.H. Krammer, M.E. Peter, Cytotoxicity-dependent APO-1 (Fas/CD95)-associated proteins form a death-inducing signaling complex (DISC) with the receptor, EMBO J. 14 (1995) 5579–5588 http://www.ncbi.nlm.nih.gov/pubmed/8521815.
[17] L. Su, B. Quade, H. Wang, L. Sun, X. Wang, J. Rizo, A plug release mechanism for membrane permeation by MLKL, Structure. 22 (2014) 1489–1500, https://doi.org/ 10.1016/j.str.2014.07.014.
[18] B.D. Bell, S. Leverrier, B.M. Weist, R.H. Newton, A.F. Arechiga, K.A. Luhrs, N.S. Morrissette, C.M. Walsh, FADD and caspase-8 control the outcome of autophagic signaling in proliferating T cells, Proc. Natl. Acad. Sci. U. S. A. 105 (2008) 16677–16682, https://doi.org/10.1073/pnas.0808597105.
[19] J.-O. Pyo, M.-H. Jang, Y.-K. Kwon, H.-J. Lee, J.-I. Jun, H.-N. Woo, D.-H. Cho, B. Choi, H. Lee, J.-H. Kim, N. Mizushima, Y. Oshumi, Y.-K. Jung, Essential roles of Atg5 and FADD in autophagic cell death: dissection of autophagic cell death into vacuole formation and cell death, J. Biol. Chem. 280 (2005) 20722–20729, https:// doi.org/10.1074/jbc.M413934200.
[20] M.M. Young, Y. Takahashi, O. Khan, S. Park, T. Hori, J. Yun, A.K. Sharma, S. Amin, C.-D. Hu, J. Zhang, M. Kester, H.-G. Wang, Autophagosomal membrane serves as platform for intracellular death-inducing signaling complex (iDISC)-mediated caspase-8 activation and apoptosis, J. Biol. Chem. 287 (2012) 12455–12468, https:// doi.org/10.1074/jbc.M111.309104.
[21] F. Basit, S. Cristofanon, S. Fulda, Obatoclax (GX15-070) triggers necroptosis by promoting the assembly of the necrosome on autophagosomal membranes, Cell Death Differ. 20 (2013) 1161–1173, https://doi.org/10.1038/cdd.2013.45.
[22] L. Tourneur, A. Buzyn, G. Chiocchia, FADD adaptor in cancer, Med. Immunol. 4 (2005) 1, https://doi.org/10.1186/1476-9433-4-1.
[23] L. Tourneur, G. Chiocchia, FADD: a regulator of life and death, Trends Immunol. 31 (2010) 260–269, https://doi.org/10.1016/j.it.2010.05.005.
[24] A. Razaghi, C. Villacrés, V. Jung, N. Mashkour, M. Butler, L. Owens, K. Heimann, Improved therapeutic efficacy of mammalian expressed-recombinant interferon gamma against ovarian cancer cells, Exp. Cell Res. 359 (2017) 20–29, https://doi. org/10.1016/J.YEXCR.2017.08.014.
[25] P. Dent, FADD the bad in head and neck cancer, Cancer Biol. Ther. 14 (2013) 780–781, https://doi.org/10.4161/cbt.26151.
[26] E.A. Slee, H. Zhu, S.C. Chow, M. MacFarlane, D.W. Nicholson, G.M. Cohen, Benzyloxycarbonyl-Val-Ala-Asp (OMe) fluoromethylketone (Z-VAD.FMK) inhibits apoptosis by blocking the processing of CPP32., Biochem. J. 315 (Pt 1 (1996) 21–4. doi:https://doi.org/10.1042/BJ3150021.
[27] L. Begović, M. Antunovic, I. Matic, I. Furcic, A. Baricevic, V. Vojvoda Parcina, P. Peharec Štefanić, B. Nagy, I. Marijanovic, Effect of UVC radiation on mouse fibroblasts deficient for FAS-associated protein with death domain, Int. J. Radiat.Biol. 92 (2016) 475–482, https://doi.org/10.1080/09553002.2016.1186298.
[28] W.C. Yeh, J.L. de la Pompa, M.E. McCurrach, H.B. Shu, A.J. Elia, A. Shahinian, M. Ng, A. Wakeham, W. Khoo, K. Mitchell, W.S. El-Deiry, S.W. Lowe, D.V. Goeddel, T.W. Mak, FADD: essential for embryo development and signaling from some, but not all, inducers of apoptosis, Science 279 (1998) 1954–1958.
[29] M. Antunovic, B. Kriznik, E. Ulukaya, V.T. Yilmaz, K.C. Mihalic, J. Madunic, I. Marijanovic, Cytotoxic activity of novel palladium-based compounds on leukemia cell lines, Anti-Cancer Drugs 26 (2015) 180–186, https://doi.org/10.1097/CAD.0000000000000174.
[30] Y.A. Lazebnik, S.H. Kaufmann, S. Desnoyers, G.G. Poirier, W.C. Earnshaw, Cleavage of poly(ADP-ribose) polymerase by a proteinase with properties like ICE, Nature.371 (1994) 346–347, https://doi.org/10.1038/371346a0.
[31] M. Raisova, A.M. Hossini, J. Eberle, C. Riebeling, C.E. Orfanos, C.C. Geilen, T. Wieder, I. Sturm, P.T. Daniel, The Bax/Bcl-2 ratio determines the susceptibility of human melanoma cells to CD95/Fas-mediated apoptosis, J. Invest. Dermatol. 117 (2001) 333–340, https://doi.org/10.1046/j.0022-202x.2001.01409.x.
[32] S.-Y. Shieh, M. Ikeda, Y. Taya, C. Prives, et al., DNA damage-induced phosphorylation of p53 alleviates inhibition by MDM2, Cell 91 (1997) 325–334, https://doi. org/10.1016/S0092-8674(00)80416-X.
[33] J.D. Siliciano, C.E. Canman, Y. Taya, K. Sakaguchi, E. Appella, M.B. Kastan, DNA damage induces phosphorylation of the amino terminus of p53, Genes Dev. 11 (1997) 3471–3481.
[34] C. Marchese, V. Maresca, G. Cardinali, F. Belleudi, S. Ceccarelli, M. Bellocci, L. Frati, M.R. Torrisi, M. Picardo, UVB-induced activation and internalization of keratinocyte growth factor receptor, Oncogene 22 (2003) 2422–2431, https://doi.org/10.1038/sj.onc.1206301.
[35] I. Tanida, T. Ueno, E. Kominami, LC3 and autophagy, Methods Mol. Biol, 2008, pp. 77–88, , https://doi.org/10.1007/978-1-59745-157-4_4.
[36] J. Zhang, D. Zhang, Z. Hua, FADD and its phosphorylation, IUBMB Life 56 (2004) 395–401, https://doi.org/10.1080/15216540400008929.
[37] P. Norris, R.N. Poston, D.S. Thomas, M. Thornhill, J. Hawk, D.O. Haskard, The expression of Endothelial Leukocyte Adhesion Molecule-1 (ELAM-1), Intercellular Adhesion Molecule-1 (ICAM-1), and Vascular Cell Adhesion Molecule-1 (VCAM-1) in experimental cutaneous inflammation: a comparison of ultraviolet B erythema and delayed Hyp, J. Invest. Dermatol. 96 (1991) 763–770, https://doi.org/10. 1111/1523-1747.EP12471720.
[38] M. Conrad, J.P.F. Angeli, P. Vandenabeele, B.R. Stockwell, Regulated necrosis: disease relevance and therapeutic opportunities, Nat. Rev. Drug Discov. 15 (2016) 348–366, https://doi.org/10.1038/nrd.2015.6.
[39] K. Newton, RIPK1 and RIPK3: critical regulators of inflammation and cell death, Trends Cell Biol. 25 (2015) 347–353, https://doi.org/10.1016/j.tcb.2015.01.001.
[40] S. Elmore, Apoptosis: a review of programmed cell death, Toxicol. Pathol. 35 (2007) 495–516, https://doi.org/10.1080/01926230701320337.
[41] M. Los, M. Mozoluk, D. Ferrari, A. Stepczynska, C. Stroh, A. Renz, Z. Herceg, Z.Q. Wang, K. Schulze-Osthoff, Activation and caspase-mediated inhibition of PARP: a molecular switch between fibroblast necrosis and apoptosis in death receptor signaling, Mol. Biol. Cell 13 (2002) 978–988, https://doi.org/10.1091/mbc.01-050272.
[42] L. Galluzzi, G. Kroemer, Necroptosis: a specialized pathway of programmed necrosis, Cell. 135 (2008) 1161–1163, https://doi.org/10.1016/j.cell.2008.12.004.
[43] H.-C. Ryu, C. Kim, J.-Y. Kim, J.-H. Chung, J.-H. Kim, UVB radiation induces apoptosis in keratinocytes by activating a pathway linked to “BLT2-reactive oxygen species”, J. Invest. Dermatol. 130 (2010) 1095–1106, https://doi.org/10.1038/JID. 2009.436.
[44] T.L. de Jager, A.E. Cockrell, S.S. Du Plessis, Ultraviolet Light Induced Generation of Reactive Oxygen Species, Springer, Cham, 2017, https://doi.org/10.1007/978-3319-56017-5_2.
[45] M.S. Ola, M. Nawaz, H. Ahsan, Role of Bcl-2 family proteins and caspases in the regulation of apoptosis, Mol. Cell. Biochem. 351 (2011) 41–58, https://doi.org/10. 1007/s11010-010-0709-x.
[46] D. Speidel, Transcription-independent p53 apoptosis: an alternative route to death, Trends Cell Biol. 20 (2010) 14–24, https://doi.org/10.1016/j.tcb.2009.10.002.
[47] T. Nakagawa, J. Yuan, Cross-talk between two cysteine protease families. Activation of caspase-12 by calpain in apoptosis, J. Cell Biol. 150 (2000) 887–894 http://www.ncbi.nlm.nih.gov/pubmed/10953012.
[48] R.V. Rao, S. Castro-Obregon, H. Frankowski, M. Schuler, V. Stoka, G. del Rio, D.E. Bredesen, H.M. Ellerby, Coupling endoplasmic reticulum stress to the cell death program. An Apaf-1-independent intrinsic pathway, J. Biol. Chem. 277 (2002) 21836–21842, https://doi.org/10.1074/jbc.M202726200.
[49] N. Godefroy, S. Bouleau, G. Gruel, F. Renaud, V. Rincheval, B. Mignotte, D. TronikLe Roux, J.-L. Vayssière, Transcriptional repression by p53 promotes a Bcl-2-insensitive and mitochondria-independent pathway of apoptosis, Nucleic Acids Res. 32 (2004) 4480–4490, https://doi.org/10.1093/nar/gkh773.
[50] N. Godefroy, C. Lemaire, F. Renaud, V. Rincheval, S. Perez, I. Parvu-Ferecatu, B. Mignotte, J.-L. Vayssière, P53 can promote mitochondria- and caspase-independent apoptosis, Cell Death Differ. 11 (2004) 785–787, https://doi.org/10.1038/sj.cdd.4401398.
[51] S.O. Kim, K. Ono, J. Han, Apoptosis by pan-caspase inhibitors in lipopolysaccharide-activated macrophages, Am. J. Physiol. Cell. Mol. Physiol. 281 (2001) L1095–L1105, https://doi.org/10.1152/ajplung.2001.281.5.L1095.
[52] P. Vandenabeele, T. Vanden Berghe, N. Festjens, Caspase inhibitors promote alternative cell death pathways, Sci. STKE 2006 (2006) pe44-pe44. doi:https://doi. org/10.1126/stke.3582006pe44.
[53] C. Scheller, J. Knöferle, A. Ullrich, J. Prottengeier, T. Racek, S. Sopper, C. Jassoy, A. Rethwilm, E. Koutsilieri, Caspase inhibition in apoptotic T cells triggers necrotic cell death depending on the cell type and the proapoptotic stimulus, J. Cell. Biochem. 97 (2006) 1350–1361, https://doi.org/10.1002/jcb.20670.
[54] H.-M. Ni, M.R. McGill, X. Chao, B.L. Woolbright, H. Jaeschke, W.-X. Ding, Caspase inhibition prevents tumor necrosis factor-α–induced apoptosis and promotes necrotic cell death in mouse hepatocytes in vivo and in vitro, Am. J. Pathol. 186 (2016) 2623–2636, https://doi.org/10.1016/J.AJPATH.2016.06.009.
[55] J.-O. Pyo, M.-H. Jang, Y.-K. Kwon, H.-J. Lee, J.-I. Jun, H.-N. Woo, D.-H. Cho, B. Choi, H. Lee, J.-H. Kim, N. Mizushima, Y. Oshumi, Y.-K. Jung, Essential roles of Atg5 and FADD in autophagic cell death, J. Biol. Chem. 280 (2005) 20722–20729, https://doi.org/10.1074/jbc.M413934200.
[56] J.M. Gump, A. Thorburn, Autophagy and apoptosis: what is the connection? Trends Cell Biol. 21 (2011) 387–392, https://doi.org/10.1016/j.tcb.2011.03.007.
[57] A. Petiot, E. Ogier-Denis, E.F. Blommaart, A.J. Meijer, P. Codogno, Distinct classes of phosphatidylinositol 3′-kinases are involved in signaling pathways that control macroautophagy in HT-29 cells, J. Biol. Chem. 275 (2000) 992–998.
[58] S. Erlich, L. Mizrachy, O. Segev, L. Lindenboim, O. Zmira, S. Adi-Harel, J.A. Hirsch, R. Stein, R. Pinkas-Kramarski, Differential interactions between Beclin 1 and Bcl-2 family members., Autophagy 3 (n.d.) 561–8.
[59] R. Kang, H.J. Zeh, M.T. Lotze, D. Tang, The Beclin 1 network regulates autophagy and apoptosis, Cell Death Differ. 18 (2011) 571–580, https://doi.org/10.1038/cdd. 2010.191.
[60] R.T. Marquez, L. Xu, Bcl-2:Beclin 1 complex: multiple, mechanisms regulating autophagy/apoptosis toggle switch, Am. J. Cancer Res. 2 (2012) 214–221.