galbus. A galI-disruption

mutant (SK-galI-5) is unable to produce galbonolide A, but can synthesize galbonolide B, indicating that galGHIJK is involved in the biosynthesis of galbonolide A. A disruption mutant of orf4 is severely impaired in the production of both galbonolides A and B. These results indicate that galGHIJK and the KAS genes are involved in the biosynthesis of galbonolides, although they are not colocalized with a multimodular PKS gene cluster. We further propose that a single galbonolide PKS generates two discrete structures, galbonolides A Alvelestat and B, by alternatively incorporating methoxymalonate and methylmalonate, respectively. Galbonolides A and B were first isolated from Streptomyces galbus ssp. eurythermus Tü 2253 based on their antifungal activities against Botrytis Selleckchem NVP-AUY922 cinerea (Fig. 1a) (Fauth et al., 1986; Achenbach et al., 1988). Galbonolides A and B were also isolated from Micromonospora

narashinoensis and Micromonospora chalcea, respectively, based on their activity against wheat stem rust fungus Puccinia graminis, and they were therefore named rustimicin and neorustimicin A (Abe et al., 1985; Takatsu et al., 1985). Furthermore, galbonolide A is also potent against several human fungal pathogens, including Cryptococcus neoformans, the causative agent of cryptococcosis. When tested against several fungal pathogens, galbonolide A was found to be much more potent than galbonolide B. It was later found that the selective inhibition of fungal sphingolipid biosynthesis, at the level of inositol phosphoceramide synthase, was responsible for the antifungal activity of

galbonolides A and B (Harris et al., 1998; Mandala et al., 1998). Based on their chemical structures, a multimodular polyketide synthase (PKS) system is predicted for the biosynthesis of galbonolides A and B. check details In modular PKS catalysis, an acyltransferase (AT) domain in each module activates and loads its substrate, which is a malonyl-thioester derivative, on the cognate acyl carrier protein (ACP) domain. The malonyl-thioester derivatives include malonyl-coenzyme A (malonyl-CoA), methylmalonyl-CoA, ethylmalonyl-CoA, chloroethylmalonyl-CoA, methoxymalonyl-ACP, hydroxymalonyl-ACP, and aminomalonyl-ACP (Hertweck, 2009). The malonyl-thioester derivative, which is attached to an ACP domain, is incorporated into a growing polyketide chain through decarboxylative Claisen condensation. This C–C bond-forming reaction is catalyzed by a β-ketoacyl synthase (KAS) domain that is associated with the ACP domain. Application of the polyketide biosynthesis paradigm to the biosynthesis of galbonolides A and B led to the hypothesis that a promiscuous precursor selection, at the installation of C-5 and C-6, results in the concurrent production of galbonolides A and B (Fig.

, 2008), the complete genome of GGSE (AP010935), and GCSD fish isolates. Genes that encode virulence traits are often associated with mobile genetic elements such as IS elements that recruit foreign genes. Moreover, IS can contribute to genetic rearrangements such as translocation, duplication, inversion, and

deletion (Vasi et al., 2000; Bongers et al., 2003; De Visser et al., 2004). The disseminations of IS981 and PD0325901 datasheet IS1161 in various isolates of streptococci collected from different sources suggested that recombination and horizontal gene transfer events might occur in these species. IS can also form compound transposons by flanking other genes to promote the horizontal gene transfer of virulence genes. It may be possible that IS981SC, IS1161, and spegg are the remnants of a compound transposon. Sachse et al. (2002) reported that the origin of spegg in S. pyogenes might be S. dysgalactiae ssp. equisimilis via horizontal gene transfer. Interestingly, the nucleotide sequence of pig isolate of GCSE PAGU657 revealed a deletion mutation at the supposed site of IS981SC insertion. IS981SC was found to mediate L. lactis mutations, including simple insertions of IS981SC into new sites of bacterial genome and recombinational IS981SC deletion from the bacterial genome (De Visser et al., 2004). This finding might explain

the five-nucleotide deletion mutation of GCSE (PAGU657) at the supposed insertion site of IS981SC, suggesting that IS981SC may contribute to virulence. The deletion and insertion mutations may contribute to the evolution of bacterial pathogenesis and selleck compound could promote recipient pathogen virulence. The present study also revealed that sagA was

also present in all of the GCSD fish isolates using the primer pair sagaF and sagaR, and the sequenced fragments revealed no difference between the predicted amino acids sequences of the sagA gene extracted from fish isolate (AB520742) and that extracted from S. dysgalactiae ssp. equisimilis (AY033399) (data not shown). Woo et al. (2003) reported that the sagA gene was identified in α-hemolytic GGSE. Immunological studies have recently provided convincing evidence that sagA is the structural gene that encodes streptolysin S. This gene was considered to be a factor contributing to the pathogenesis O-methylated flavonoid of streptococcal necrotizing soft tissue infection (Humar et al., 2002) and to the virulence potential of S. iniae infection in fish (Locke et al., 2007). Our findings indicate that α-hemolytic fish GCSD isolates carried some virulence genes that may be responsible for S. dysgalactiae ssp. equisimilis virulence and pathogenesis. Therefore, α-hemolytic fish GCSD isolates should not be disregarded as putative infectious disease agents in humans and mammals. The authors are grateful to Dr Lauke Labrie, head of the aquatic animal health team of Schering-Plough Animal Health, Singapore, for kindly providing S. dysgalactiae isolates.

CMV oesophagitis is treated with ganciclovir 5 mg/kg bd iv for 2–4 weeks, or until symptoms/signs have resolved (category III recommendation) [14,15]. Valganciclovir may be substituted for iv ganciclovir at 900 mg bd orally for some or all of the duration if symptoms are not severe enough to interfere with oral absorption on the basis of studies showing efficacy for CMV disease in transplant patients [16] but there is a paucity of data in HIV-related CMV disease of the gastrointestinal tract (category IV recommendation). Secondary CMV prophylaxis for oesophageal disease is

not routinely indicated, Z-VAD-FMK supplier unless there is concomitant ophthalmological disease. Herpes simplex oesophagitis is treated with aciclovir 5–10 mg/kg tid iv, followed by 400 mg five times a day orally for a total of 14 days (category III recommendation) [17] or oral valaciclovir ATR activation 1 g bd orally (see 6 Herpes viruses for a discussion of prophylaxis of HSV). Foscarnet 90 mg/kg bd iv has been used in cases

of ganciclovir-resistant CMV or 40 mg/kg bd or tid for aciclovir-resistant HSV [15]. After presentation with infectious oesophagitis, early initiation of HAART should be considered (category IV recommendation) [18]. As elsewhere in these guidelines, early initiation of HAART is favoured on the basis that improved survival without AIDS progression or death has been seen when HAART is initiated within the first two Inositol oxygenase weeks of treatment of the opportunistic infection [18]. This recommendation is extrapolated from a series in which most cases were not related to oesophageal opportunistic infection but is also supported by evidence of functional immunological benefits of antiretrovirals against organisms such as Candida spp. [19]. Diarrhoea is a common problem for people with HIV in both resource-poor and resource-rich settings, regardless of antiretroviral exposure. In the pre-HAART

era, 30–70% of HIV-seropositive individuals experienced diarrhoea, and among European patients with CD4 counts <50 cells/μL, 49% would expect to develop diarrhoea within 1 year and 96% within 3 years [20]. In resource-poor areas, incidence and severity continue to be higher. Early clinical observations confirmed that diarrhoeal illness was linked to reduced quality of life and poorer survival [21]. Diarrhoea may be the presenting symptom of lymphoma and Kaposi’s sarcoma, may affect up to 40–50% of those taking antiretroviral therapy (ART), can be induced by other medications and may be the result of an incompletely defined direct effect of HIV on the gut mucosa termed HIV-associated enteropathy [22–25].

bulgaricus (1% viability) resulted in degradation of proteins Cisplatin ic50 and peptides and such degraded proteins, if exposed on the bacterial cell wall, may be the cause of the increased cytokine production. Taking into account the bacterial viability

after lyophilization, this works out to a 6 : 1 ratio of live bacteria to splenocytes. Baba et al. (2008) found that a low bacterial to dendritic cell (DC) ratio results in a reduction of cytokine (IL-10, IL-12p70 and TNFα) production. Thus, the increase in cytokine production reported here is probably due to the dead bacteria. The ability of L. casei to induce IL-12p40 increased by more than threefold, IL-10 by 10-fold and TNFα by 2.4-fold (Table 1) (P<0.001). Lactobacillus bulgaricus and L. rhamnosus induced significantly more IL-10 (1.5- and 3.8-fold, respectively) (P<0.001) after being lyophilized, but there was no change in TNFα or IL-12p40 production (Table 1). Lyophilization changed the order of cytokine induction by these bacteria such that this website for TNFα: L. bulgaricus>L. casei>L. rhamnosus; for IL-12p40: L. bulgaricus=L. casei>L. rhamnosus; and for IL-10: L. bulgaricus>L. rhamnosus>L. casei.

To determine whether the cytoplasmic components or the cell wall architecture disruption are the cause of the increased cytokine secretion, we carried out contact inhibition experiments. In the presence of the membrane inserts, the production of TNFα and IL-10 (by both live and lyophilized lactobacilli) was abrogated and drastically reduced, respectively (Fig. 2a and b) (P<0.001), indicating that direct contact between lactobacilli and spleen cells was important for cytokine induction. This reflects Megestrol Acetate the necessity for the engagement of membrane receptors and/or phagocytosis. The low level of IL-10 production was probably due to soluble bacterial products as in the presence of the membranes, there was still significantly more IL-10 than in the

media alone (P<0.05). The roles of TLRs in lactobacilli stimulation of splenocytes were evaluated using TLR-blocking antibodies or oligonucleotides. As both TLR1 and TLR6 require an association with TLR2 for activation, blocking TLR2 will effectively block interactions with either of these receptors as well; thus, we used anti-TLR2 antibodies. The anti-TLR2 antibody had a negligible effect on L. casei-induced TNFα production, while there was a 20% and 60% reduction in TNFα production by L. bulgaricus and L. rhamnosus, respectively (Fig. 3a). Lactobacillus rhamnosus-stimulated IL-10 secretion was abrogated after TLR2 blocking (by 80%), while IL-10 induction by L. bulgaricus was reduced by 30% (Fig. 3b). IL-12 production was independent of TLR2 (Fig. 3c). When spleen cells were treated with anti-TLR4 antibody or anti-TLR9 oligonucleotides, the production of all three cytokines remained unchanged, indicating that TLR4 and TLR9 had little influence on the induction of these cytokines by lactobacilli (data not shown).

volcanii and E. coli. pAJ successfully expressed proteins in Hfx. volcanii or E. coli, rendering it feasible to express target proteins in corresponding domains. In addition, pAJ contains a multiple cloning site with 11 restriction sites and a 6×His tag sequence, and the vector size was decreased to 8903 bp. To the best of our knowledge, pAJ is the first reported shuttle expression vector that can express proteins in both Bacteria and Archaea. Importantly, pAJ can even express the haloarchaeal heat shock VX-809 nmr protein DnaK in both domains. In conclusion, this novel vector only provides researchers with a new means to manipulate genes

or express proteins in Haloarchaea but also serves as a convenient tool for the comparative study of the function of some highly conserved genes in Haloarchaea and in Bacteria. “
“The present study describes the assimilation of phenanthrene by an aerobic bacterium, Ochrobactrum sp. strain PWTJD, isolated from municipal waste-contaminated soil sample

utilizing phenanthrene as a sole source of carbon and energy. The isolate was identified as Ochrobactrum sp. based on the morphological, nutritional and biochemical characteristics as well as 16S rRNA gene sequence analysis. A combination of chromatographic analyses, oxygen uptake assay and enzymatic studies confirmed the degradation of phenanthrene by the strain PWTJD via 2-hydroxy-1-naphthoic acid, salicylic acid and catechol. The strain PWTJD could also utilize 2-hydroxy-1-naphthoic acid and Tofacitinib manufacturer salicylic acid, while the former was metabolized by a ferric-dependent meta-cleavage dioxygenase. In the lower pathway, salicylic acid was metabolized to catechol and was further degraded by catechol 2,3-dioxygenase to 2-hydroxymuconoaldehyde acid, ultimately leading to tricarboxylic acid cycle intermediates. This is the first report of

the complete degradation of a polycyclic aromatic hydrocarbon molecule by Gram-negative Ochrobactrum sp. describing the involvement of the meta-cleavage pathway of 2-hydroxy-1-naphthoic acid in phenanthrene assimilation. Polycyclic aromatic hydrocarbons (PAHs) comprise a large of and diverse group of priority environmental pollutants, which are ubiquitous contaminants derived from both natural and anthropogenic activities. Their abundance in the environment is of great concern, because many of them have been shown to be toxic, mutagenic and/or carcinogenic in nature (Mastrangelo et al., 1996; Marston et al., 2001; Xue & Warshawsky, 2005). The stability, persistency and carcinogenic index of PAHs increase with an increase in the number of aromatic rings, structural angularity and hydrophobicity (Marston et al., 2001). Phenanthrene has often been used as a model compound to study the microbial metabolism of bay- and K-region-containing PAHs because its structural skeletons are found in many carcinogenic PAHs.

The bacterial strains and plasmids used in this study are listed in Table 1. The E. coli strain Keio:JW0157 was kindly gifted

by the National BioResource Project (National Institute of Genetics, Japan) (Baba et al., 2006). Keio:JW0157(DE3) was created using the λDE3 Lysogenization Kit (Invitrogen, Carlsbad, CA). Bacterial strains were routinely cultured in Luria–Bertani (LB) medium or on LB agar plates at 37 °C with appropriate antibiotics (20 μg mL−1 chloramphenicol for strains harboring pCCM, 50 μg mL−1 ampicillin for strains harboring pET derivatives). For the construction of pET101::QPO, QPO-encoding this website region from A. actinomycetemcomitans ATCC29522 was amplified using KOD (Toyobo, Osaka, Japan) and the following appropriate primers: (1) qpo_topo_f1, caccATGAAAAAATTTGCACTGAAAACG; the first codon of QPO is underlined, Dasatinib and the sequence in lower-case letters was attached to the 5′ end for use in the Directional TOPO cloning system (Invitrogen). (2) qpo_topo_r, TTATTGTAATTTTTTGCCTTCAAACTC; the stop

codon of QPO is underlined. The resulting PCR products were ligated with pET101topo (Invitrogen) as per the manufacturer’s instructions. For the construction of pCCM, the entire cytochrome c maturation (ccm) gene region was amplified from E. coli K-12 using PrimeSTAR (Takara, Kyoto, Japan) with the following oligonucleotide pair: GATATCCTGCCCGATATGCGTGAA-5′ (CCM_F) as the upstream primer and GTCGACTTATTTACTCTCCTGCGGCG-5′ (CCM_R) as the downstream primer. The 6355-bp DNA fragment Rolziracetam obtained using the PCR was ligated with pZero-2 plasmid vector (Invitrogen). This construct was then digested with EcoRV and SalI and ligated with pACYC184 to obtain pCCM. Escherichia coli was cultured overnight to stationary phase at 25 °C under aerobic conditions in LB medium for spontaneous (‘leaky’) expression of rQPO.

All the following steps were conducted at 4 °C. Bacterial cells were harvested by centrifugation at 3000 g for 15 min. The cell pellet was reddish, indicating heme overproduction. The pellet was washed with 10 mM potassium phosphate buffer (pH, 8.0) and then resuspended and sonicated in the same buffer. The membrane fraction was obtained as a pellet after centrifugation at 60 000 g for 1 h. rQPO was solubilized with 10 mM potassium phosphate buffer (pH, 8.0) containing 0.5% (w/v) sucrose monolaurate (SM-1200; Nacalai Tesque Inc., Kyoto, Japan) and obtained as the supernatant after centrifugation at 60 000 g for 1 h. The solubilized rQPO was loaded onto a Macro-Prep Ceramic Hydroxyapatite Type I column (1.6 × 3 cm; Bio-Rad) that was pre-equilibrated with 10 mM potassium phosphate buffer (pH, 8.0) containing 0.5% (w/v) SM-1200. The column was washed with 10 mL of the same buffer, and bound proteins were eluted with a 20-mL gradient of 0.1–1.0 M potassium phosphate (pH, 8.0) at a flow rate of 0.

Low-level (<10 000 copies/mL) episodes of viral failure appeared to have a small Fluorouracil and temporary impact on subsequent CD4 cell counts. However, periods of viral failure >10 000 copies/mL were associated with a substantial reduction in subsequent

CD4 cell counts. The most dramatic impact of viral failure was on CD4 cell counts measured within 6 weeks of viral failure but, even up to a year after a viral load >10 000 copies/mL, geometric mean CD4 cell counts were lower in patients who had previously experienced viral failure. Effects of treatment interruption on subsequent CD4 cell counts appeared largely explained by virological failure. Among patients with baseline CD4 counts ≥500 cells/μL and at least one viral load >1000 copies/mL, CD4 counts declined between 4 and 8 years of follow-up (ratio of geometric means 0.86; 95% CI 0.78–0.93). In contrast, CD4 cell counts increased over the same period among those who did not experience virological failure (ratio of geometric means 1.11; 95% CI 1.05–1.16). this website Because

of this contrast, and because random-effects models account for drop-out when this is predictable from observed CD4 cell counts, we do not think that this decline is likely to be explained by loss to follow-up. A plausible explanation for these findings is that some patients discontinue treatment because they feel that their CD4 cell counts are sufficiently high. In particular, women with high CD4 cell counts who are

treated in order to prevent mother-to-child transmission may discontinue treatment after giving birth: unpublished analyses of data from this cohort suggest that higher rates of treatment discontinuation in women than in men are less pronounced after excluding pregnant women, and others have reported similar findings [21,22]. Interestingly, our estimates of the impact of O-methylated flavonoid a higher viral load on subsequent CD4 increases did not depend substantially on whether treatment had been maintained or discontinued (permanently or temporarily), suggesting that viral replication has a similar impact on the immune system, whether or not treatment is still being taken. Our data collection tool does not collect information on all complete breaks (i.e. no drugs) in treatment of <2 weeks, which may mean that we underestimate the impact of treatment discontinuation on our estimates of the effects of virological failure on subsequent CD4 cell count increases. Several studies of trends in post-cART CD4 cell counts according to baseline CD4 cell counts have reported more than 4 years of follow-up among patients maintaining low viral loads. Of these, two reported increases in CD4 cell counts beyond 5 years of treatment in all baseline CD4 cell count groups [16,23].

0001) compared with those who were virally suppressed >90% of the time, and those who had virally rebounded in the year prior to baseline had a 3.1-times higher rate of virological failure compared with patients who had never virally rebounded (95% CI 1.84–5.25; P<.0001). The analyses were also repeated using a lower limit of detection for viral load of 50 copies/mL;

901 patients were included Romidepsin research buy in the analysis and 41% experienced virological failure (defined as a viral load >50 copies/mL), with an IR of 14.3 per 100 PYFU (95% CI 12.8–15.8). Those who had virally rebounded in the year prior to baseline had an 84% higher rate of virological failure compared with patients who had never virally Sorafenib mouse rebounded (95% CI 1.33–2.57; P=0.0003) and patients who were virally suppressed <50% of the time they were on cART had a 13% higher rate of virological failure (95% CI 0.79–1.64; P=0.50) compared with those who were virally suppressed >90% of the time, although this was not statistically significant after adjustment. Five hundred and forty-four patients (29%) had some resistance data available at baseline. Four hundred and five patients (75%)

had a GSS ≥3 for their baseline cART regimen; there was no significant difference in rate of virological failure in patients with a GSS<3 compared with those with a GSS ≥3 (IRR 1.41; 95% CI 0.89–2.23; P=0.14) after adjustment for all demographic variables, percentage of time suppressed and time since last rebound. A patient's history of viral suppression can provide important information about the risk of viral failure after a change in ARVs. The variables describing the history of viral suppression after cART initiation but before a change in regimen were highly predictive of future virological failure, in addition to the traditional baseline predictors. The most important factors were the percentage of time spent with suppressed viral load since starting cART prior to baseline and time since last viral rebound. After adjustment for these factors, none of the other Thymidylate synthase markers of previous patterns of suppression

was a significant predictor of virological failure after baseline. There was a clear inverse relationship between time suppressed and risk of future virological failure. Patients with viral suppression <50% of the time prior to baseline had almost double the rate of virological failure compared with those with viral suppression >90% of the time. A study in patients with CD4 counts >200 cells/μL found that time with undetectable viraemia was a significant predictor of clinical progression [30]. In addition, previous studies have found that patients with a history of persistent low-level viraemia (51–1000 copies/mL) were more likely to experience virological failure [31], as were those with intermittent viraemia above 400 copies/mL, compared with those who sustained an undetectable viral load [32].

5% of the Māori MSM and 37.5% of the Pacific MSM. A difference in HIV testing Regorafenib research buy by ethnicity, particularly lower rates among Pacific MSM, has also been seen in community surveys. In the 2006 Gay Auckland Periodic Sex Survey (GAPSS) [16], the respective proportions for these ethnic groups were 77, 75 and 40%, and in the 2008 GAPSS, 80, 77 and 60% [17]. The use of agreed definitions for late presentation allows international comparisons. The proportion of ‘late presentations’ among people diagnosed with HIV infection in the European Union (EU) in 2009 has recently been reported [18]. Among the 28 EU countries that report on HIV diagnoses, 18 countries monitored initial CD4 cell counts, 11 of which obtained

this information on more than half of the cases. The 2009 data for these countries (Table 6)

show that the proportion of cases for which we had this information in New Zealand for 2005–2010 (80%) was only surpassed by two of these countries. The proportion of ‘late presentations’ among MSM in New Zealand was similar to that in the UK, France and Spain but higher than that in six other countries. Among heterosexually infected people, the proportion of ‘late presentations’ was again similar to that in the UK and also to that in the Netherlands, but higher than that in seven other countries, Selleck Obeticholic Acid although our exclusion of people diagnosed through immigration might have affected this comparison. These comparisons show that in recent years New Zealand has a very similar pattern of late presentation to that found Sitaxentan in the UK and several other Northern European countries. In Australia, initial CD4 cell counts were also available for about 80% of people diagnosed with HIV infection over the period 2005–2008 [19]. The initial CD4 count was <200 cells/μL for about 20% of all patients for whom this was available; and <350 cells/μL for about 40%, somewhat lower than our comparable proportions of 31 and 50%. The median CD4 count among all MSM diagnosed with HIV infection in Australia in the

period 2005–2009 was 460 cells/μL, slightly higher than for MSM in New Zealand for 2005–2010, for whom it was 404 cells/μL. As both Australia and New Zealand have had recent increases in the number of new infections of HIV among MSM, this suggests less testing in New Zealand. This is supported by gay community periodic surveys in Australia which in 2008 found rates of HIV testing in the previous 12 months of between 52 and 62% [20], compared with 45% in a similar survey in Auckland in that year. The major implication of these findings is that more efforts should be made to diagnose HIV infection early. Delayed testing has an impact not only on the well-being of individuals but also on the future spread of the epidemic in populations and groups. Mathematical modelling in Australia suggests that those with undiagnosed chronic HIV infection are likely to be responsible for a disproportionate number of new infections [21].

, 1991). In these proteins, the conserved histidine residues act to co-ordinate an oxo-bridged di-iron cluster (Fe-O-Fe) that functions as part of the reaction center (Fox et al., 1993; Shanklin et al., 1994). The closest OlsE homologs

are present in all the sequenced Agrobacterium strains, Rhodospirillum centenum, Parvibaculum lamentivorans, Verrucomicrobium spinosum, Micavibrio aeruginosavorus, this website and Azospirillum amazonense. More distant homologs are present in several actinomycetes, a few Gammaproteobacteria, and a few other Alphaproteobacteria (Table S1). No growth phenotype was observed for the OlsE–deficient mutant at increased temperatures or under pH stress conditions. Bean plants infected with OlsE-deficient mutants presented less red nodules and more white

nodules than plants infected with the wild type. Nitrogen fixation of nodules from OlsE mutant-infected plants was clearly reduced (Vences-Guzmán et al., 2011). In G. cerinus, a taurine residue can be amide-linked to the α-amino group of the ornithine moiety of OL (Tahara et al., b). It has been shown that a cell-free protein crude extract from G. cerinus contains an enzymatic activity responsible for the transfer of taurine to OL hydroxylated in the 2-position of the piggy-back fatty acid. This taurine transfer activity depends on the presence of ATP and bivalent cations (Tahara et al., b). As no G. cerinus strain has been sequenced so far, a bioinformatic search for Pifithrin-�� mouse candidate genes/proteins has not been possible. The wealth of genome sequence information that has been produced in recent years allows for an accurate analysis of the distribution of OL biosynthesis

genes. Genes coding for OlsB have a high predictive value, and it should be possible to predict the capacity of an organism to synthesize OL from the presence of the olsB gene. In many cases, where the olsB gene is phylogenetically less well conserved, the fact that olsB often occurs in an operon with olsA is of help. For the purpose of predicting the distribution of OLs, we analyzed all sequenced bacterial genomes for the presence of a gene encoding an OlsB homolog. BLAST searches with OlsB sequences from S. meliloti and B. cenocepacia pick up OlsB homologs in about 25% of the sequenced bacterial species which belong to the Alpha-, Beta-, Gamma-, Deltaproteobacteria, Actinomycetales, spirochetes, PIK-5 green nonsulfur bacteria, verrucomicrobia, firmicutes, Aquificales, and cyanobacteria (Table S1). Within the class Alphaproteobacteria, OlsB homologs can be detected in most sequenced species belonging to the orders Rhizobiales, Rhodobacterales, and Rhodospirillales, but are generally absent from species belonging to the orders Caulobacterales, Rickettsiales, and Sphingomonadales. OlsB can also be detected in the majority of sequenced Betaproteobacteria, including most Burkholderiales and many Neisseriales, but are absent from the Nitrosomonales.